Skip to main content

Table 1 Primers and parameters used in the PCR

From: Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia, Mytilidae)

Gene Sequences of the primers Denaturation Annealing Elongation
28S LR10R: 5'GACCCTGTTGAGCTTGA3'
LR12: 5'GACTTAGAGGCGTTCAG3'
95°C, 20 s 48°C, 20 s 72°C, 30 s
5S F: 5'CAACGTGATATGGTCGTAGAC3'
R: 5'AACACCGGTTCTCGTCCGATC3'
95°C, 30 s 44°C, 30 s 72°C, 30 s
h2ba F: 5'TCCCGAGATGTGATGGTAGA3'
R: 5'AGTACAGCCTGGATGTTTGGTAA3'
95°C, 30 s 45°C, 30 s 72°C, 40 s
h3 F: 5'ATGGCTCGTACCAAGCAGACVGC3'
R: 5'ATATCCTTRGGCATRATRGTGAC3'
95°C, 15 s 48°C, 15 s 72°C, 15 s